The RF Map module can process any number of FastQ files, both from single-read or paired-end experiments. Reads are first pre-processed (trimmed and clipped), and mapped to the reference transcriptome.
The resulting SAM/BAM files can be then passed to the RF Count module.

Usage

$ rf-map [options] file1.fastq ... filen.fastq.gz
$ rf-map [options] file1_R1.fastq,file1_R2.fastq ... filen_R1.fastq.gz,filen_R2.fastq.gz

To list the required parameters, simply type:

$ rf-map -h

Parameter	Type	Description
-b2 or --bowtie2		Uses Bowtie v2 for reads mapping (Default: Bowtie v1)
-p or --processors	int	Number of processors (threads) to use (Default: 1)
-wt or --working-threads	int	Number of working threads to use for each instance of SAMTools/Bowtie (Default: 1). Note: RT Counter executes 1 instance of SAMTools/Bowtie for each processor specified by -p. At least -p <processors> * -wt <threads> processors are required.
-o or --output-dir	string	Output directory for writing mapped reads in SAM/BAM format (Default: rf_map/)
-ow or --overwrite		Overwrites the output directory if already exists
-t or --tmp-dir	string	Path to a directory for temporary files creation (Default: /tmp ) Note: If the provided directory does not exist, it will be created
-nb or --no-bam		Disables conversion of SAM files to BAM format
-b or --bowtie	string	Path to bowtie (or bowtie2) executable (Default: assumes bowtie/bowtie2 is in PATH)
-c or --cutadapt	string	Path to cutadapt executable (Default: assumes cutadapt is in PATH)
-s or --samtools	string	Path to samtools executable (Default: assumes samtools is in PATH)
-kl or --keep-logs		Disables logs folder deletion (mostly for debugging purposes)
		Cutadapt options
-ca5 or --cutadapt-5adapter	string	Sequence of 5' adapter to clip (Default: CAAGTCTCAAGATGTCAGGCTGCTAG, Illumina/NEBNext Small RNA 5’ Adapter) Note #1: Sequence of 5' adapter will be automatically reverse-complemented Note #2: Multiple adapter sequences can be provided as a comma-separated list
-ca3 or --cutadapt-3adapter	string	Sequence of 3' adapter to clip (Default: AGATCGGAAGAGCACACGTCT, NEBNext Small RNA 3’ Adapter) Note: Multiple adapter sequences can be provided as a comma-separated list
-cq5 or --cutadapt-5quality	int	Quality threshold for trimming bases from read 5'-ends (Phred+33, Default: 0 [no trimming]) Note: 5'-end quality trimming must be avoided when analyzing data from RT-stop-based methods
-cq3 or --cutadapt-3quality	int	Quality threshold for trimming bases from read 3'-ends (Phred+33, Default: 20)
-cqo or --cutadapt-quality-only		Disables adapters clipping (only performs quality-based trimming)
-cl or --cutadapt-len	int	Minimum length to keep reads after clipping (≥10, Default: 25)
-cm or --cutadapt-min-align	int	Minimum alignment in nt to adapter’s sequence (>0, Default: 1)
-ctn or --cutadapt-trim-N		Trims Ns at the end of the read
-cmn or --cutadapt-max-N	float	Discards reads with more than this number of Ns (Default: off) Note: if a value between 0 and 1 is provided, this is interpreted as a fraction of read's length
-cp or --clipped		Assumes that reads have been already clipped
		Mapping options
-mp or --mapping-params	string	Manually specify additional aligner parameters (e.g. -mp "-n 2 -l 15") Note: for a complete list of aligner's parameters, please check the aligner's documentation
-mo or --manual-only		Only uses manually specified aligner's parameters. Any other parameter, except -bi (or --bowtie-index), will be ignored
-bk or --bowtie-k	int	Reports up to this number of mapping positions for reads (Default: disabled)
-ba or --bowtie-all		Reports all mapping positions for reads (Default: disabled)
-bnr or --bowtie-norc		Maps only to transcript's sense strand (Default: both strands)
-b5 or --bowtie-trim5	int	Number of bases to trim from 5'-end of reads (≥0, Default: 0)
-b3 or --bowtie-trim3	int	Number of bases to trim from 3'-end of reads (≥0, Default: 0)
-bi or --bowtie-index	string	Path to transcriptome reference index (see rf-index)
		Bowtie v1 options
-bl or --bowtie-seedlen	int	Seed length (≥5, Default: 28)
-bn or --bowtie-n	int	Use Bowtie mapper in -n mode (0-3, Default: 2) Note: in -n mode, Bowtie admits no more than -bn mismatches in the seed
-bv or --bowtie-v	int	Use Bowtie mapper in -v mode (0-3, Default: disabled) Note: in -v mode, Bowtie admits no more than -bv mismatches in the entire read (Phred quality ignored)
-bm or --bowtie-max	int	Discard read if more than this number of alignments exist (Default: 1)
-bc or --bowtie-chunkmbs	int	Maximum MB of RAM for best-first search frames (Default: 128)
		Bowtie v2 options
-bl or --bowtie-seedlen	int	Seed length (3 ≤ l ≤ 32, Default: 22)
-bN or --bowtie-N	int	Bowtie seed mismatches (0-1, Default: 0)
-bD or --bowtie-D	int	Maximum number of seed extension attempts (≥0, Default: 15)
-bR or --bowtie-R	int	Maximum number of re-seeding attempts for reads with repetitive seeds (≥0, Default: 2)
-bmp or --bowtie-mp	int[,int]	Maximum and minimum mismatch penalities (≥0, Default: 6,2)
-bdp or --bowtie-dpad	int	Number of extra reference bases included on sides of the DP table (≥0, Default: 15)
-bdg or --bowtie-rdg	int[,int]	Read's gap open and extend penalities (≥0, Default: 5,3)
-bfg or --bowtie-rfg	int[,int]	Reference's gap open and extend penalities (≥0, Default: 5,3)
-bs or --bowtie-softclip		Enables local alignment mode (Default: entire read must align)
-bma or --bowtie-ma	int	Match bonus in local alignment mode (Default: 2)
-bd or --bowtie-dovetail		Paired-end dovetailed reads are allowed (mates extend past each other)