The RF Map module can process any number of FastQ files, both from single-read or paired-end experiments. Reads are first pre-processed (trimmed and clipped), and mapped to the reference transcriptome.
The resulting SAM/BAM files can be then passed to the RF Count module.

Usage

$ rf-map [options] file1.fastq ... filen.fastq.gz
$ rf-map [options] file1_R1.fastq,file1_R2.fastq ... filen_R1.fastq.gz,filen_R2.fastq.gz

To list all avalailable parameters, simply type:

$ rf-map -h

Parameter	Type	Description
-b2 or --bowtie2		Uses Bowtie v2 for reads mapping (Default: Bowtie v1)
-p or --processors	int	Number of processors (threads) to use (Default: 1)
-wt or --working-threads	int	Number of working threads to use for each instance of SAMTools/Bowtie (Default: 1). Note: RT Counter executes 1 instance of SAMTools/Bowtie for each processor specified by -p. At least -p <processors> * -wt <threads> processors are required.
-o or --output-dir	string	Output directory for writing mapped reads in SAM/BAM format (Default: rf_map/)
-ow or --overwrite		Overwrites the output directory if already exists
-t or --tmp-dir	string	Path to a directory for temporary files creation (Default: /tmp ) Note: If the provided directory does not exist, it will be created
-nb or --no-bam		Disables conversion of SAM files to BAM format
-b or --bowtie	string	Path to bowtie (or bowtie2) executable (Default: assumes bowtie/bowtie2 is in PATH)
-c or --cutadapt	string	Path to cutadapt executable (Default: assumes cutadapt is in PATH)
-s or --samtools	string	Path to samtools executable (Default: assumes samtools is in PATH)
-kl or --keep-logs		Disables logs folder deletion (mostly for debugging purposes)
		Cutadapt options
-ca5 or --cutadapt-5adapter	string	Sequence of 5' adapter to clip (Default: CTACACGACGCTCTTCCGATCT, Illumina/NEBNext Small RNA 5’ Adapter) Note #1: Sequence of 5' adapter will be automatically reverse-complemented Note #2: Multiple adapter sequences can be provided as a comma-separated list
-ca3 or --cutadapt-3adapter	string	Sequence of 3' adapter to clip (Default: AGATCGGAAGAGCACACGTCT, NEBNext Small RNA 3’ Adapter) Note: Multiple adapter sequences can be provided as a comma-separated list
-cq5 or --cutadapt-5quality	int	Quality threshold for trimming bases from read 5'-ends (Phred+33, Default: 0 [no trimming]) Note: 5'-end quality trimming must be avoided when analyzing data from RT-stop-based methods
-cq3 or --cutadapt-3quality	int	Quality threshold for trimming bases from read 3'-ends (Phred+33, Default: 20)
-cqo or --cutadapt-quality-only		Disables adapters clipping (only performs quality-based trimming)
-cl or --cutadapt-len	int	Minimum length to keep reads after clipping (≥10, Default: 25)
-cm or --cutadapt-min-align	int	Minimum alignment in nt to adapter’s sequence (>0, Default: 1)
-ctn or --cutadapt-trim-N		Trims Ns at the end of the read
-cmn or --cutadapt-max-N	float	Discards reads with more than this number of Ns (Default: off) Note: if a value between 0 and 1 is provided, this is interpreted as a fraction of read's length
-cp or --clipped		Assumes that reads have been already clipped
		Mapping options
-mp or --mapping-params	string	Manually specify additional aligner parameters (e.g. -mp "-n 2 -l 15") Note: for a complete list of aligner's parameters, please check the aligner's documentation
-mo or --manual-only		Only uses manually specified aligner's parameters. Any other parameter, except -bi (or --bowtie-index), will be ignored
-bk or --bowtie-k	int	Reports up to this number of mapping positions for reads (Default: disabled)
-ba or --bowtie-all		Reports all mapping positions for reads (Default: disabled)
-bnr or --bowtie-norc		Maps only to transcript's sense strand (Default: both strands)
-b5 or --bowtie-trim5	int	Number of bases to trim from 5'-end of reads (≥0, Default: 0)
-b3 or --bowtie-trim3	int	Number of bases to trim from 3'-end of reads (≥0, Default: 0)
-bi or --bowtie-index	string	Path to transcriptome reference index (see rf-index)
		Bowtie v1 options
-bl or --bowtie-seedlen	int	Seed length (≥5, Default: 28)
-bn or --bowtie-n	int	Use Bowtie mapper in -n mode (0-3, Default: 2) Note: in -n mode, Bowtie admits no more than -bn mismatches in the seed
-bv or --bowtie-v	int	Use Bowtie mapper in -v mode (0-3, Default: disabled) Note: in -v mode, Bowtie admits no more than -bv mismatches in the entire read (Phred quality ignored)
-bm or --bowtie-max	int	Discard read if more than this number of alignments exist (Default: 1)
-bc or --bowtie-chunkmbs	int	Maximum MB of RAM for best-first search frames (Default: 128)
		Bowtie v2 options
-bl or --bowtie-seedlen	int	Seed length (3 ≤ l ≤ 32, Default: 22)
-bN or --bowtie-N	int	Bowtie seed mismatches (0-1, Default: 0)
-bD or --bowtie-D	int	Maximum number of seed extension attempts (≥0, Default: 15)
-bR or --bowtie-R	int	Maximum number of re-seeding attempts for reads with repetitive seeds (≥0, Default: 2)
-bmp or --bowtie-mp	int[,int]	Maximum and minimum mismatch penalities (≥0, Default: 6,2)
-bdp or --bowtie-dpad	int	Number of extra reference bases included on sides of the DP table (≥0, Default: 15)
-bdg or --bowtie-rdg	int[,int]	Read's gap open and extend penalities (≥0, Default: 5,3)
-bfg or --bowtie-rfg	int[,int]	Reference's gap open and extend penalities (≥0, Default: 5,3)
-bs or --bowtie-softclip		Enables local alignment mode (Default: entire read must align)
-bma or --bowtie-ma	int	Match bonus in local alignment mode (Default: 2)
-bd or --bowtie-dovetail		Paired-end dovetailed reads are allowed (mates extend past each other)

Sample labeling

By default, RF Map uses the input file names (stripped of their extension) as labels in the output files.

It is however possible to specify custom labels by prepending them to the input files, in the form label::

$ rf-map [options] Sample_1:file1.fastq Sample_2:file2.fastq .. Sample_N:fileN.fastq